Skip to main content
Article
Rapid Communication: Mapping the Pig VCAM1 Locus to Chromosome 4 Using a Double-Stranded Conformation Polymorphism Marker (VCAM1-2)
Journal of Animal Science
  • Christopher K. Tuggle, Iowa State University
  • T. P. Yu, Iowa State University
  • H. S. Sun, Iowa State University
  • L. Wang, Iowa State University
  • Max F. Rothschild, Iowa State University
Document Type
Article
Publication Version
Published Version
Publication Date
1-1-1997
DOI
/1997.7582286x
Abstract

Source and Description of Primers. We previously identified a SacI polymorphism by using a pig VCAM1 cDNA probe on Southern blots (VCAM1-1; Helm et al., 1994). This polymorphism was not informative enough to map VCAM1. To develop PCR-based genotyping, we sequenced the 3¢ untranslated region of pig VCAM1. Subsequently, a pig VCAM1 cDNA was deposited in Genbank; our data agree completely with that reported by Tsang et al. (Accession: U08351). The PCR primers were designed (forward, 5¢-TATCAGCCCTCCATAGTCACAT 3¢ and reverse, 5¢- GAAATTGTTGTCCATGACCTTTAT 3¢) .

Comments

This is an article from Journal of Animal Science 75 (1997): 2286, doi:/1997.7582286x. Posted with permission.

Copyright Owner
American Society of Animal Science
Language
en
File Format
application/pdf
Citation Information
Christopher K. Tuggle, T. P. Yu, H. S. Sun, L. Wang, et al.. "Rapid Communication: Mapping the Pig VCAM1 Locus to Chromosome 4 Using a Double-Stranded Conformation Polymorphism Marker (VCAM1-2)" Journal of Animal Science Vol. 75 Iss. 8 (1997) p. 2286 - 2286
Available at: http://works.bepress.com/max-rothschild/101/